Latest Ubuntu related questions

Score: 1
Chintan Kaneriya avatar
Too much RAM is being used even if the system is moderately ideal in Ubuntu 20.4?
dk flag

We are using Ubuntu 20.4

System Configurations: 240GB SSD, 8 GB RAM, Intel® Core™ i5-4440 CPU @ 3.10GHz × 4

we are using a few software like Google Chrome, Vs code and Notepad ++. We have noticed that the system is using too much RAM even if we are not using that many apps. Like for ex. there's only Google Chrome and File manager is opened and they are not even being used. they are in the ideal  ...

Score: 1
suhani avatar
Ubuntu 18.04, Lost control of brightness after grub crashes
in flag

I updated ubuntu version 16.04 to 18.04 on my Dell Vostro-3478 almost a year ago. Last few days, the screen was freezing again and again and i had to restart it each time. The grub crashed yesterday when i tried to connect the wifi. Somehow managed to log into system using rescue mode. But now, neither the F key(for brightness) nor the brightness control in system settings is working.

Although i  ...

Score: 1
I firstly installed ChromeOS with Brunch and then Kubuntu on my Laptop. Now grub doesn't recognize Chrome OS. How to add Chrome OS to Grub?
jp flag
Zed

I am new to the Linux world. I recently installed Chrome OS with Brunch on my laptop. Later I installed Kubuntu but grub does not recognize the ChromeOS I installed earlier. It only allows me to boot into Kubuntu.

Here's what my partitions look like: enter image description here

What should I do to add ChromeOS into grub as an option so it works as dual-boot?

Thank you so much!

Score: 1
Steflan avatar
Issue with VMWare on Ubuntu 20.04 after kernel change
lu flag

I have been using VMWare on Ubuntu for a while now and yesterday I received an error saying my /boot partition was full so I started googling how to fix this by removing unused headers

I ended up following the steps in this article to try and fix it, but today after booting up my system I started getting the following error:

Image of Error

I would normally get this error when doing a kernel change as I use secu ...

Score: 3
Sagar avatar
Ubuntu 20.04LTS - not recognizing Wifi intermittently
ru flag

The issue I am facing is quite strange. I am using Ubuntu 20.04 LTS on my Dell inspiron laptop. The issue is sometimes my Wifi network wont even show up in the list . The network list will show other nearby Wifi(s) but not mine. I tried to restart multiple times but no use. If i dont use a laptop for a day, then next day it would recognize my Wifi and will work fine for few days . I checked other questi ...

Score: 0
Best RAID combination
cn flag

got a question, very new to raid != 1/0 systems here. I have 2x3TB hard disks + 2x2tb hard disks + 1x1tb hard disk which I would like to "group" in a RAID-X having some sort of fault tollerance. Do you think it's possible without losing space? Which kind of RAID? Actually they're setup (3+3 and 2+2, 1 is mounted alone) in 2 different mdadm arrays mirroring, but the second is pretty much empty and I woul ...

Score: 0
Dara Srivathsa avatar
How to remove a kernel from ubuntu?
in flag

I'm using Ubuntu along side windows in dual boot. I downloaded, compiled and booted linux-stable kernel from Linux's official repository. Now I want to remove this kernel, I tried searching online.

But when i use dpkg --list | grep linux-image, I couldn't find linux-stable kernel which i downloaded, So I couldn't follow online guide.

srivathsa@srivathsa:~$ dpkg --list | grep linux-image
ii  linux-i ...
Score: 0
Ubuntu Core 20: "Out of resources" before installer starts
vn flag

I'm trying to install Ubuntu Core 20 onto a pretty grunty Dell R420 Server with 192GB RAM and 4 x 2TB storage.

I believe that it meets the requirements of having 384MB RAM (512MB with UEFI Secure Boot and FDE) and 256MB storage.

I have created the USB boot disk and selected UEFI boot from the BIOS menu and selected my USB key.

GRUB appears, offering me the options:

Recover using 20210630
Install using  ...
Score: 0
user3057099 avatar
intel-sdw message in dmesg
cn flag

I've a Acer Swift 3 laptop running Ubuntu 20.04.2 LTS.

Recently I started getting the following message continuously in my dmesg:

[ 1850.107303] sdw_cdns_irq: 163616 callbacks suppressed
[ 1850.107307] intel-sdw intel-sdw.0: Bus clash for control word
[ 1850.107334] intel-sdw intel-sdw.1: Bus clash for control word

Does anyone know what it means?

Noticed that this errors comes with linux kernel 5.11 if  ...

Score: 2
contributorpw avatar
Error while loading shared libraries: libQt5WebEngineWidgets.so.5: cannot open shared object file: No such file or directory
cn flag

I'm trying exec the https://biz.mail.ru/myteam/

It works from the /tmp dir. But if I try run it from another dir it fails

$> ~/myteam
/home/user/myteam: error while loading shared libraries: libQt5WebEngineWidgets.so.5: cannot open shared object file: No such file or directory

Reinstall of libqt5* packages is not effect.

It seems the links between libs aren't configured correctly.

What happens? H ...

Score: 0
Fazle Rabbi avatar
Guest can't access internet in KVM NAT
hu flag

Guests can't access internet in KVM NAT network. Guest can't ping host, the home router and other hosts on the lan but can't access website or ping DNS like 1.1.1.1 or 8.8.8.8

Step to reproduce:

  1. On a fresh installation of Ubuntu 20.04 Desktop, I installed QEMU, KVM, bridge-utils and virt-manager with the following command: sudo apt-get install qemu-kvm libvirt-daemon-system libvirt-clients bridge-utils ...

Score: 0
Justin avatar
How do you append the first pattern of a regular expression to the end of a line using sed?
ke flag

I have a .fasta (text) file containing DNA sequence data in the format as follows:

>uce-8374_Genus_species
ACGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTACGATCGCGGTATATCGGCGATTCGATCG

>uce-239_Genus_species
ATCGTAGCATGCGCTAGCTAGCTAGCTCGCGGTACGCATGTCTGACTGCGTCTGGTCGTACGATTACTACGACTGCG

>uce-83_Genus_species
ATCGATCTAGCGTAGCATGCGATCGATATCTGCGATCGACTCGATGCATGCATGCATCGATGCTAGCTAGCTAGCTA

&gt ...
Score: 0
Ivan Freiberg avatar
WIFI is so slow with Kubuntu 20.04 in notebook HP
id flag

I tried all from all forums and I can't fix this problem. I receive 40 mbps from 100 mbps.

This is my wireless controller:

02:00.0 Network controller [0280]: Realtek Semiconductor Co., Ltd.

RTL8723DE 802.11b/g/n PCIe Adapter [10ec:d723]

My kernel is 5.11.0.31-generic

ip link:

1: lo: <LOOPBACK,UP,LOWER_UP> mtu 65536 qdisc noqueue state UNKNOWN mode DEFAULT group default qlen 1000
    link/loopback ...
Score: 0
shanock avatar
Netplan config with Gateway outside subnet
cn flag

I'm having trouble with some routing. I cannot get to 192.168.1.1 Below is the config. I have tried with onlink and without. Not sure what onlink does really. There are a few switches this machine goes through before it would hit the router. is there something i'm missing? ip route show shows that it has added the routes correctly.

Thanks!

Netplan config

network:
  renderer: networkd
  ethernets:
    enp ...
Score: 0
Pedro Ruas avatar
Bluetooth headphones auto-connection not working properly
cn flag

So, this is more of a "polishing experience" type of thing, and not truly needed, but...

I have a pair of Bluetooth earbuds that auto turn on when taken out of box. Well, on Windows, Android and iOS they connect automatically and stay working perfectly, including sound and touch controls.

On Ubuntu they connect and immediately disconnect, like half a second later. After that, I can manually connect  ...

The Stunning Power of Questions

Much of an executive’s workday is spent asking others for information—requesting status updates from a team leader, for example, or questioning a counterpart in a tense negotiation. Yet unlike professionals such as litigators, journalists, and doctors, who are taught how to ask questions as an essential part of their training, few executives think of questioning as a skill that can be honed—or consider how their own answers to questions could make conversations more productive.

That’s a missed opportunity. Questioning is a uniquely powerful tool for unlocking value in organizations: It spurs learning and the exchange of ideas, it fuels innovation and performance improvement, it builds rapport and trust among team members. And it can mitigate business risk by uncovering unforeseen pitfalls and hazards.

For some people, questioning comes easily. Their natural inquisitiveness, emotional intelligence, and ability to read people put the ideal question on the tip of their tongue. But most of us don’t ask enough questions, nor do we pose our inquiries in an optimal way.

The good news is that by asking questions, we naturally improve our emotional intelligence, which in turn makes us better questioners—a virtuous cycle. In this article, we draw on insights from behavioral science research to explore how the way we frame questions and choose to answer our counterparts can influence the outcome of conversations. We offer guidance for choosing the best type, tone, sequence, and framing of questions and for deciding what and how much information to share to reap the most benefit from our interactions, not just for ourselves but for our organizations.