Latest Ubuntu related questions

Score: 3
halt not emitting any logging/shutdown info, how to improve robust reporting or visual logging?
bd flag

I'm struggling with an Ubuntu system that is not doing anything visually following sudo halt. This is Ubuntu 20.04 and is running in on a macOS Parallels host system. I have four other Ubuntu instances on this particular system (one 18.04, two 20.04, and one 22.04) and they all halt in usual and expected ways that are not like the particular instance I'm asking about here.

Normally in such a server c ...

Score: 5
neahan avatar
Unable to use KDE desktop due to autologin
kw flag

I recently moved from Windows to Ubuntu but now I want to use a different dekstop (KDE rather than GNOME). I installed KDE Plasma Desktop using the instructions here: https://itsfoss.com/install-kde-on-ubuntu/ and rebooted my laptop but it just auto logs me back into GNOME. I've also tried...

  1. removing autologin in my settings:

Settings > Users

  1. amending /etc/gdm3/custom.conf in terminal/nano
Score: 0
ronbaby avatar
How do I report a problem to for a pre-built package?
bw flag

I recently installed the "timeline" app on my Ubuntu 20.xx system.

It mostly works but produces horrible failures when and if it is used to try to export to an SVG file.

This problem is apparently due to the absence, on my Ubuntu 20,xx system, of a particular Python package called wxPython.

I have tried to get that package installed, but my attempts to install wxPython are failing.

Simple question: How c ...

Score: -1
Keashell avatar
How to remove manually installed Python version in opt?
tm flag

I'm using the latest version of Ubuntu, and I recently followed this tutorial: https://www.youtube.com/watch?v=aYUH08BM37g as part of a course for learning Python, and no longer need it. I was never able to use it or create an interpreter for Pycharm with it anyways, even though I could do so with the other versions of Python, so it's just dead weight on my computer.

We've now switched to more cu ...

Score: 1
Joe Moore avatar
Unable to SSH into Ubuntu Server 20.04
no flag

Before I begin, I am very aware of this thread. This question is not a duplicate of that one because the troubleshooting from that thread has not fixed my issue.

I have set up an ubuntu 20.04 server on a raspberry pi 4. I have installed openssh-server on that server and enabled it. I have also assigned it a static IP in the netplan

network:
  version: 2
  ethernets:
    eno1:
      dhcp4: false
    ...
Score: 0
Kfir Yehezkel avatar
Failed to upgrade Linux kernel to 4.0.15-194 on ubuntu 18.04 running on Hyper-v
gg flag

I have a windows machine running with Hyper-V running Ubuntu 18.04 32Bit. The Linux kernel version is : 4.15.0.91-generic. When trying to upgrade to the recent kernel. 4.15.0-194 it ends but fails to restart. The last message shown is:

Started update UTMP about System Runlevel Changes....el crash signature

Since this is Hyper-c machine so I use the option "revert" to the last VM checkpoint, but I pref ...

Score: 0
r-c-man avatar
Trying to add a line to my bashrc but it's not working
tv flag

I am trying to add a line after I find some text to my .bashrc but I don't have my syntax correct.

Can someone help me.

I want to add the line "alias cls='clear' after the egrep line in the .bashrc file.

Here is what I have so far.

sed ':\egrep:a alias cls='clear' .bashrc

Thanks RC

Score: 0
Aftermaz avatar
Can't install Ubuntu 22.04 alongside with Windows 11
hn flag

I have HP Envy x360 laptop with Windows 11 on it. It has AMD Ryzen 7 and AMD graphic card. I'm trying to install Ubuntu 22.04 with USB drive as dual boot but I have no luck so far.

When I try to select 'Try or install Ubuntu' in grub, I just got stuck on loading screen (with HP logo). Pressing ESC shows the following:

[1 of 3] A start job is running for Network Name Resolution (time/time)

[2 of 3] A  ...

Score: 2
Leafia Dias avatar
volume and mute buttons not working on Ubuntu
ua flag

It has been days since my volume buttons and the mute button work correctly. I have been trying everything related to pulse audio that could have caused this. Reinstalling, resetting my volume and mute keys, and doing an alsa force reload but nothing works.

Score: 3
schuelermine avatar
How does Ubuntu theme GDM?
us flag

I’ve checked a few things already.

The file /usr/share/gnome-shell/gnome-shell-theme.gresource is stock GNOME.
The directory /etc/gdm3/ contains no mention of “Yaru” or “theme” except for commented out lines, ditto for /usr/share/gdm/.
I’ve also taken a cursory glance at /var/lib/gdm3/greeter-dconf-defaults using strings, and it doesn’t seem to mention themes or Yaru either.

I’m u ...

Score: 7
Paulo Henrique avatar
How to have light theme with dark window titlebar on Ubuntu 22.04?
uz flag

I have updated my Ubuntu to 22.04.1 version and with this new version of gnome I can't change the color of Window Title Bar. So, in the older version, the Yaru theme (example) the title bar looks like:

enter image description here

I the new version, with the same configuration (as far I know), the title bar looks:

enter image description here

I tried to change the color in the configuration of the gtk.css file, without success - I can't find the border colors  ...

Score: 0
blackened avatar
Stacking windows without a window manager
id flag

(Ubuntu 22.04.)

I suppose the following is somewhat trivial with a window manager, but I couldn't get used to window managers yet.

This is what I often need in my current workflow: I have a code editor occupying half of the screen (or so), and Google Chrome snapped-occupying the other half. I also need Chrome Dev Tools open; but I need it stacked on the top of Google Chrome exactly. And I prefer to  ...

Score: 1
Naeem Navjivan avatar
How to install Mongodb in a docker container and use it?
cn flag

I'm using Ubuntu 22.04 LTS, as of Oct 2022 ubuntu 22.04 is not supported by Mongodb team completely, So I'm struggling with it as I need mongodb-org installed for my work. So my question is, Is there anyway I can install mongodb in a docker container and use it??? I don't know much about docker if anyone knows how can I achieve this that will be really appreciated.

Score: 5
user58292 avatar
How to make Ubuntu stop offering to upgrade from 20.04.5 to 22.04.1?
jp flag

I have installed (fresh) Ubuntu 20.04.5 on a laptop. It keeps offering to upgrade to 22.04.1 (downgrade?!) from the initial install through all subsequent updates. Obviously it should not be doing this.

Version Contradiction

What's going on and how to I fix it?

Score: 10
Kilix avatar
NVIDIA driver is no longer working with new kernel
mn flag

The nvidia-driver-515-open (proprietary, tested) is no longer working with my GeForce RTX 3080 Lite Hash Rate. I'm running Ubuntu 22.04. Everything was fine until an update last week. The 5.15.0-50-generic produces regular screen blanks. The nvidia-driver-515 (proprietary) boots to a blank screen only.

Under 5.15.0-48-generic with nvidia-driver-515-open (proprietary, tested) the system is more st ...

Score: -2
Naeem Navjivan avatar
How to install ubuntu on SSD and windows 10 on HDD
cn flag

I'm using ubuntu 22.04 LTS installed in SSD (128Gb) and windows 10 installed in HDD (1 Tb). So my question is I want to switch to some other distro, is possible to just format and install the new linux on SSD while the HDD with windows 10 stays untouched??

Score: 4
Sergi avatar
Firefox can't open files
cn flag

I just updated from Ubuntu 20.04 to 22.04 and it looks since then Firefox can't open a file. When I download a file from a website, I get the dialog box "Open with... System Handler (default)". I try that and it looks the file is downloaded but I can't open it or even access the folder when it was downloaded. I have Firefox 105.0.3 (64 bits) Mozilla Firefox Snap for Canonical-002 - 1.0

Score: 0
OldGitU.K. avatar
Unable to complete upgrade from Ubuntu 20.01LTS to 20.04
fr flag

Been running Ubuntu 20.04LTS and really happy with it. Running my dual boot desktop after moving home all has been well. I powered on today and got invite to upgrade which I decided to do. My usual diligence did not go far enough I don't think and need urgent help! It appeared to go perfectly well until prompted to reboot to complete the process. I did this and entered my password to enable shut down bu ...

Score: 1
bobbboo avatar
how to go back to original Ethernet settings?
uz flag

I was messing with my internet settings because it was going on and off. When I tried a terminal command suggested on google, it deleted my wired network settings - this is what I see:

enter image description here

Even tho my WiFi is still working fine I would definitely prefer the Ethernet cable which is not even detected in the bios. Thanks in advance if you have any solutions.

Output of ip link show:

1: lo: <LOOPBACK,UP,L ...
Score: 1
DEEP avatar
To make separate files based on pattern within a single file
id flag

I have a file containing 2.3M lines. Which looks like:

$less V2.fastq

>TS19_EWP4IQK02JPFP5
CATGCTGCCTCCCGTAGGAGTTTGGTCCGTGTCTCAGTACCAATGTGGGGGACCTTCCTC
TCAGAACCCTATCCATCGTCGGTTTGGTGGGCCGTTACCCGCCAACTGCCTAATGGAACG
CATGCCTATCTATCAGCGATGAATCTTTAGCAAATATCCCCATGCGGGGCCCTGCTTCAT
GCGGTATTAGTCCGACTTTCGCCGGGTTATCCCCTCTGATAGGTAAGTTGCATACGCGTT
ACTCACCGTGCGCCGG
>TS20_EWP4IQK02FSQQL
CATGCTGCCTCCCGTAGGAGTTTGGACC ...
Score: 1
medskillz avatar
Cannot install nvidia driver 515 in ubuntu 22.04
fr flag

I installed a new system with 22.04 after an old 20.04 system broke down in the same space.

I just can't install the nvidia driver for my rtx 3090.

I downloaded the driver version 515.76 from nvidia for ubuntu 22.04 x64 version and ran it where it was downloaded with sudo ./"nameofdriver".run

The install then gets stuck here:

enter image description here

I also tried to install with the GUI "additional drivers" and to directly inst ...

Score: 0
David N Raychel avatar
Realtek usb wifi not being seen as network class interface?
bi flag

I have installed (synaptic) 8812au driver on ubuntu studio 20.04.4 LTS. The problem exists on another machine with 16.04 as well lsusb sees the device. The device doesn't get associated with being a network interface. Is there a file that needs to be edited for the system to see it as a second wlan interface?

Score: 0
Camilo Febres avatar
How can I use the convert program of ImageMagick and also keep the quality?
gb flag

I have a lot of .ps images and I need them in .png, so I found that the convert program could help me, however, every time I did the conversion like this: convert foo.ps foo.png the quality of the resulting image was very low. After reading the manual, I tried: convert foo.ps -quality 100 foo.png, but I didn't get different results, neither raising the 100 to 200 or more.

Score: 0
user2005218 avatar
What is causing ubuntu 20.04.5 to become inaccessible via SSH?
cn flag

For a long time I ran Ubuntu 16LTS as my home server. After setting up a new server with Ubuntu 20 there are times where I simply cannot access the server via SSH. As far as I can tell, the system has powered off as there is no fan activity to indicate it is on. The system is connected to the same UPS as the old server and is well within the capacity of the UPS. The UPS status usb is not connected.

 ...
Score: 0
Elio avatar
Constant power outages, wasting time to determine the last executed command in my .sh script. What command to use to record progress?
in flag

(I found a perfect solution by using Google Forms and a simple curl command, I wrote it as an answer if anyone ever needs it)

I execute a long .sh script with thousands of commands and once a power outage occurs, I need a lot of time to determine which was the last executed command so I can resume working. I need a creative solution first regarding where the log would be the best to be stored (locall ...

Score: 0
simonmikkelsen avatar
After upgrade to 22.04 cifs uses uid and gid from remote device instead the specified a mount
ni flag

For many years I have mounted my Synology NAS via cifs with the uid and gid options in /etc/fstab, so Ubuntu presented the file tree as owned by this user/group and the NAS wrote the files as written by the user specified in the mount. This worked fine.

Now I just upgraded to Ubuntu 22.04 and it seems to have taken the approch to read and respect the permissions in the filesystem on the NAS. The issue i ...

Score: -1
HHS avatar
How to circumvent script Kiddee app?
ru flag
HHS

I have a Dell Inspirion 5558 running Ubuntu 20.04.02. While staying in a hotel ("free Wi-Fi") someone scooped up my username/password and used it to install a small script that, upon immediately booting past the Dell logo presents a page the claims it is from Dell Security and requests username/password to access the computer. The problem is that the entire screen is filled with a black border that offe ...

Score: 1
Native OneDrive not following configuration that is displayed with --display-config, causes constant pop-ups
US flag

I installed native onedrive (not from PPA). Auth, started a sync.

Using /home/user/ as the sync_dir so it uses the Documents Pictures and Desktop directories for my user.

I set it to skip dot files, and also to check for .nosync, then I touch .nosync files in the directories I did not want synced like Downloads, VirtualBox\ VMs etc.

I keep getting these notifications for OneDrive no such file or direct ...

Score: 1
not_a_smart_person avatar
I have forgotten my password. Is there anything I can do?
ao flag

Preface: my question is not the typical "I have forgotten my password" question.

I am running Ubuntu 22.04

I have forgotten the password to both my administrative account and for hard drive encryption. That being said, the machine in question is currently on and logged into a non-administrative account (i.e. I'm using it right now to type this.)

I realize that if I turn the machine off, the encryption key ...

Score: 6
AlastairG avatar
sudo ubuntu-drivers autoinstall: UnboundLocalError: local variable 'version' referenced before assignment
cn flag

I recently re-installed my wife's XUbuntu 22 machine. Previously we used the NVidia driver package from the NVidia website, especially after a bit of a f&%k up last year where the official repo version broke due to broken dependencies.

This time I thought I would give the repo version another go, especially since my wife is scared of re-installing the graphics drivers after a kernel update -  ...

The Stunning Power of Questions

Much of an executive’s workday is spent asking others for information—requesting status updates from a team leader, for example, or questioning a counterpart in a tense negotiation. Yet unlike professionals such as litigators, journalists, and doctors, who are taught how to ask questions as an essential part of their training, few executives think of questioning as a skill that can be honed—or consider how their own answers to questions could make conversations more productive.

That’s a missed opportunity. Questioning is a uniquely powerful tool for unlocking value in organizations: It spurs learning and the exchange of ideas, it fuels innovation and performance improvement, it builds rapport and trust among team members. And it can mitigate business risk by uncovering unforeseen pitfalls and hazards.

For some people, questioning comes easily. Their natural inquisitiveness, emotional intelligence, and ability to read people put the ideal question on the tip of their tongue. But most of us don’t ask enough questions, nor do we pose our inquiries in an optimal way.

The good news is that by asking questions, we naturally improve our emotional intelligence, which in turn makes us better questioners—a virtuous cycle. In this article, we draw on insights from behavioral science research to explore how the way we frame questions and choose to answer our counterparts can influence the outcome of conversations. We offer guidance for choosing the best type, tone, sequence, and framing of questions and for deciding what and how much information to share to reap the most benefit from our interactions, not just for ourselves but for our organizations.